Review



lef1 c12a5 rabbit mab cell signaling technology  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc lef1 c12a5 rabbit mab cell signaling technology
    Lef1 C12a5 Rabbit Mab Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 310 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm41307998-265-63-67
    Average 96 stars, based on 310 article reviews
    lef1 c12a5 rabbit mab cell signaling technology - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Recombinase Polymerase Amplification:

    Article Title: Multidimensional profiling of human T cells reveals high CD38 expression, marking recent thymic emigrants and age-related naive T cell remodeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BD OptiBuild BUV563 Mouse Anti-Human CD195, clone 2D7/CCR5 BD Cat# 741401, RRID:AB_2870893 BD OptiBuild BUV737 Rat Anti-Human CCR7 (CD197), clone 3D12 BD Cat# 741786, RRID:AB_2871135 BD OptiBuild BUV805 Mouse Anti-Human CCR9, clone C9Mab-1 BD Cat# 752799, RRID:AB_2917779 BD Pharmingen APC Mouse Anti-Human CCR9 (CD199), clone C9Mab-1 BD Cat# 567976, RRID:AB_2916803 BD Horizon APC-R700 Mouse Anti-Human CD127, clone HIL-7R-M21 BD Cat# 565185, RRID:AB_2739099 BD Horizon BV650 Mouse Anti-Human CD127, clone HIL-7R-M21 BD Cat# 563225, RRID:AB_2738081 BD OptiBuild BV786 Mouse Anti-Human CD159c (NKG2C), clone 134591 BD Cat# 748170, RRID:AB_2872631 BD Horizon BUV496 Mouse Anti-Human CD16, clone 3G8 BD Cat# 612944, RRID:AB_2870224 BD Horizon BV480 Mouse Anti-Human CD19, clone SJ25C1 BD Cat# 566103, RRID:AB_2739505 BD Pharmingen APC-H7 Mouse Anti-Human CD27, clone M-T271 BD Cat# 560223, RRID:AB_1645473 BD Horizon BUV805 Mouse Anti-Human CD3, clone SK7 BD Cat# 612894, RRID:AB_2870182 BD Horizon BV421 Mouse Anti-Human CD4, clone RPA-T4 BD Cat# 562424, RRID:AB_11154417 BD OptiBuild BUV395 Mouse Anti-Human CD45RA, clone 5H9 BD Cat# 740315, RRID:AB_2740052 BD Horizon RB780 Mouse Anti-Human CD69, clone FN50 BD Cat# 568755 BD OptiBuild BV510 Mouse Anti-Human CD93, clone R139 BD Cat# 743196, RRID:AB_2741335 BD OptiBuild BUV615 Mouse Anti-Human CD183 (CXCR3), clone 1C6/CXCR3 BD Cat# 751126, RRID:AB_2875154 BD OptiBuild BV650 Rat Anti-Human CXCR5 (CD185), clone RF8B2 BD Cat# 740528, RRID:AB_2740238 BD Horizon PE-CF594 Mouse Anti-Human FoxP3, clone 236A/E7 BD Cat# 563955, RRID:AB_2738507 BD Pharmingen Alexa Fluor 488 Armenian Hamster Anti-Helios, clone 22F6 BD Cat# 563950, RRID:AB_2738505 BD Horizon BUV737 Rat Anti-Human IL-2, clone MQ1-17H12 BD Cat# 612836, RRID:AB_2870158 BD Horizon BV510 Mouse Anti-Human IL-8, clone G265-8 BD Cat# 563311, RRID:AB_2738132 BD Horizon R718 Mouse Anti-TCF-7/TCF-1, clone S33-966 BD Cat# 567587, RRID:AB_2916656 BD OptiBuild BUV661 Mouse Anti-Human TCR Va7.2, clone OF-5A12 BD Cat# 750392, RRID:AB_2874562 Alexa Fluor 647 Rabbit Anti-Lef1, clone C12a5 Cell Signaling Cat# 14022S PE anti-human PTK7, clone 188B Miltenui Biotec Cat# 130-122-923 Human NKp80/KLRF1 Alexa Fluor 647-conjugated Antibody, clone 239127 R&D Systems Cat# FAB1900R100 Super Bright 436 anti-human CD123, clone 6H6 ThermoFisher Cat# 62-1239-42 PerCP-eFluor 710 anti-human GzmK, clone G3H69 ThermoFisher Cat# 46-8897-42 PE-Cyanine7 anti-human KLRG1, clone 13F12F2 ThermoFisher Cat# 25-9488-42 PE anti-TOX, clone TXRX10 ThermoFisher Cat# 12-6502-82 (Continued on next page) e2 Immunity 57, 1–18.e1–e10, October 8, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human PBMCs, see Table S2 This paper N/A Human thymocytes This paper N/A Chemicals, peptides, and recombinant proteins Human TruStain FcX 200 tests BioLegend Cat# 422302 Brilliant Stain Buffer Plus BD Cat# 566385 Brefeldin A ThermoFisher Cat# 00-4506-51 Ionomycin calcium salt from Streptomyces conglobatus Sigma Cat# I0634-1MG Phorbol 12-myristate 13-acetate Sigma Cat# P8139-1MG Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation ThermoFisher Cat# 11161D Recombinant Human IL-7 (carrier-free) BioLegend Cat# 581902 Recombinant Human IL-15 (carrier-free) BioLegend Cat# 570302 Proteinase K Sigma Cat# P4850-1ML Critical commercial assays CryoStor CS10 Freeze Media Biolife Solutions Cat#210102 EasySep Human Naı̈ve Pan T Cell Isolation Kit StemCell Cat# 17961 EasySep Human Naı̈ve CD8+ T Cell Isolation Kit StemCell Cat# 19258 EasySep Human Naı̈ve CD4+ T Cell Isolation Kit StemCell Cat# 19555 RNeasy Plus Micro Kit QIAGEN Cat# 74034 LIVE/DEAD Fixable Blue viability dye Invitrogen Cat# L34962 LIVE/DEAD Fixable Green viability dye Invitrogen Cat# L34969 CellTrace Violet Cell Proliferation Kit, for flow cytometry Invitrogen Cat# C34557 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat# 00-5523-00 Platinum Quantitative PCR SuperMix-UDG ThermoFisher Cat# 11730017 Deposited data Raw and processed single-nuclei multiome of CD4 and CD8 naive cells This paper Synapse: syn53238645 Raw and processed bulk RNA-seq of CD38 subsets This paper Synapse: syn53238645 Raw and processed bulk RNA-seq of naive CD4 and CD8 cell stimulation This paper Synapse: syn53238645 Processed scRNA-seq with CD8 and CD4 T cells (ABF300 project) Terekhova et al.7 syn49637038 Processed scRNA-seq with CD8 and CD4 T cells Mogilenko et al.20 syn22255433 Processed single-cell object with human thymus cells Park et al.25 https://developmentcellatlas.ncl.ac.uk/ Bulk RNA-seq data of naive T cells after thymectomy van den Broek et al.17 GEO: GSE72400 Normalized microarray dataset of fetal CD4 thymocytes Lee et al.30 GEO: GSE1460 Normalized microarray dataset of human CD8 naive T cell subsets (CXCR3 sorting) De Simone et al.43 GEO: GSE125102 Normalized microarray dataset of human naive CD4 T cell subsets (CD25 sorting) Pekalski et al.57 ArrayExpress: E-MTAB-4853 Raw and processed spectral cytometry data This paper Synapse: syn53238646 Oligonucleotides Primer: TREC Forward: CACATCCCTTTCAACCATGCT IDT N/A Primer: TREC Reverse: GCCAGCTGCAGGGTTTAGG IDT N/A Recombinant DNA TaqMan probe FAM-ACACCTCTGGTTTTTGT AAAGGTGCCCACT-TAMRA ThermoFisher Cat# 450025 TREC plasmid GeneArt Construct ID 18ACJFZP (Continued on next page) Immunity 57, 1–18.e1–e10, October 8, 2024 e3



    Similar Products

    96
    Cell Signaling Technology Inc lef1 c12a5 rabbit mab cell signaling technology
    Lef1 C12a5 Rabbit Mab Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm41307998-265-63-67
    Average 96 stars, based on 1 article reviews
    lef1 c12a5 rabbit mab cell signaling technology - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit monoclonal cell signaling technology 2230 cone c12a5 anti sox9
    Rabbit Monoclonal Cell Signaling Technology 2230 Cone C12a5 Anti Sox9, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm39476839-1030-73-75
    Average 96 stars, based on 1 article reviews
    rabbit monoclonal cell signaling technology 2230 cone c12a5 anti sox9 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc c12a5 cell signaling
    C12a5 Cell Signaling, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm39321807-232-293-294
    Average 93 stars, based on 1 article reviews
    c12a5 cell signaling - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    92
    Cell Signaling Technology Inc lef1 c12a5 cell signaling technology
    Lef1 C12a5 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/Phospho-CREB+(Ser133)+Rabbit+mAb/pmc11030415__NIHPP2024__04__09__588427v1___supplement___1-285-129-131
    Average 92 stars, based on 1 article reviews
    lef1 c12a5 cell signaling technology - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc clone c12a5
    Clone C12a5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm38278150-228-215-217
    Average 96 stars, based on 1 article reviews
    clone c12a5 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc lef1 cell signaling tech c12a5
    Lef1 Cell Signaling Tech C12a5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/LEF1+Rabbit+mAb/pm37882990-52-81-82
    Average 95 stars, based on 1 article reviews
    lef1 cell signaling tech c12a5 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc lef1 c12a5 cell signaling tech
    Figure 3. SIX2+CITED1+ cell self-renewal: the role of the extracellular matrix niche. A,B) Representative immunofluorescence staining showing the distribution of ITG𝛽1 (green) and SIX2 (red) in hFK (10 WGA) and WT (WT#12, favorable stage III) A) and for ITG𝛽1 (red) and CITED1 (green) in hFK (10 WGA) and WT (WT#8 favorable stage II. B) Nuclei stained with DAPI (blue); scale bars 50 and 75 μm, respectively. C) Heatmap showing gene expression profile for integrins in SIX2+CITED1+ cells from hFK (17, 17.2, and 17.5 WGA) and WT (WT#3 anaplastic stage I, WT#4: non-anaplastic, stage III, and WT#5: non-anaplastic chemo-treated, stage IV). D) Densitometric analysis by western blot (WB) of ITG𝛽1 expression in freshly isolated SIX2+CITED1+ cells from WT (WT#8,11,12, favorable stage II, favorable stage III, and favorable stage II) versus SIX2+CITED1+ cells from hFK (15,16,18 WGA) showing higher expression of ITG𝛽1 in hFK cells; 𝛽-actin was used as housekeeping protein for normalization. WB bands are presented below the graph, *p < 0.05. E) Representative immunofluorescence staining of SIX2 (red) and CITED1 (green) in SIX2+CITED1+ cells from hFK (17 WGA) cultured for 72 h with/without 1 μg mL−1 anti-ITG𝛽1 or 0.5 μg mL−1 anti-ITG𝛽4 neutralizing antibody showing increased expression of CITED1 in cells treated with anti-ITG𝛽1. Nuclei stained with DAPI (blue). Scale bar = 50 μm. F,G) Percentage of SIX2+CITED1+ cells and total SIX2+ cells from hFK (17 WGA) by flow cytometry analysis after F) 5 d or G) 28 d of culture with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody or a combination of both. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; mean ± SEM. H) Densitometric analysis by WB of <t>LEF1</t> protein expression in hFK SIX2+CITED1+ cells (17 WGA) cultured for 28 d with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody 𝛽-actin was used as housekeeping control. WB bands are presented below the graph. *p < 0.05. I) Kaplan-Meier survival analysis of mice injected with WT SIX2+CITED1+ cells, without treatment (control, n = 4) or with the treatment of anti-ITG𝛽1 (n = 5) or anti-ITG𝛽4 (n = 4), endpoint tumor size 1.5 cm. J) Schematic representation showing the proposed role of ITG𝛽1 and ITG𝛽4 in WT SIX2+CITED1+ cells.
    Lef1 C12a5 Cell Signaling Tech, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/GSK-3beta+Rabbit+mAb/pm37114795-335-10-12
    Average 96 stars, based on 1 article reviews
    lef1 c12a5 cell signaling tech - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Cell Signaling Technology Inc cell signaling c12a5 antibody
    Figure 3. SIX2+CITED1+ cell self-renewal: the role of the extracellular matrix niche. A,B) Representative immunofluorescence staining showing the distribution of ITG𝛽1 (green) and SIX2 (red) in hFK (10 WGA) and WT (WT#12, favorable stage III) A) and for ITG𝛽1 (red) and CITED1 (green) in hFK (10 WGA) and WT (WT#8 favorable stage II. B) Nuclei stained with DAPI (blue); scale bars 50 and 75 μm, respectively. C) Heatmap showing gene expression profile for integrins in SIX2+CITED1+ cells from hFK (17, 17.2, and 17.5 WGA) and WT (WT#3 anaplastic stage I, WT#4: non-anaplastic, stage III, and WT#5: non-anaplastic chemo-treated, stage IV). D) Densitometric analysis by western blot (WB) of ITG𝛽1 expression in freshly isolated SIX2+CITED1+ cells from WT (WT#8,11,12, favorable stage II, favorable stage III, and favorable stage II) versus SIX2+CITED1+ cells from hFK (15,16,18 WGA) showing higher expression of ITG𝛽1 in hFK cells; 𝛽-actin was used as housekeeping protein for normalization. WB bands are presented below the graph, *p < 0.05. E) Representative immunofluorescence staining of SIX2 (red) and CITED1 (green) in SIX2+CITED1+ cells from hFK (17 WGA) cultured for 72 h with/without 1 μg mL−1 anti-ITG𝛽1 or 0.5 μg mL−1 anti-ITG𝛽4 neutralizing antibody showing increased expression of CITED1 in cells treated with anti-ITG𝛽1. Nuclei stained with DAPI (blue). Scale bar = 50 μm. F,G) Percentage of SIX2+CITED1+ cells and total SIX2+ cells from hFK (17 WGA) by flow cytometry analysis after F) 5 d or G) 28 d of culture with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody or a combination of both. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; mean ± SEM. H) Densitometric analysis by WB of <t>LEF1</t> protein expression in hFK SIX2+CITED1+ cells (17 WGA) cultured for 28 d with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody 𝛽-actin was used as housekeeping control. WB bands are presented below the graph. *p < 0.05. I) Kaplan-Meier survival analysis of mice injected with WT SIX2+CITED1+ cells, without treatment (control, n = 4) or with the treatment of anti-ITG𝛽1 (n = 5) or anti-ITG𝛽4 (n = 4), endpoint tumor size 1.5 cm. J) Schematic representation showing the proposed role of ITG𝛽1 and ITG𝛽4 in WT SIX2+CITED1+ cells.
    Cell Signaling C12a5 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c12a5+cell+signaling/anti+lef1/pmc04416270-323-26-71
    Average 90 stars, based on 1 article reviews
    cell signaling c12a5 antibody - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Figure 3. SIX2+CITED1+ cell self-renewal: the role of the extracellular matrix niche. A,B) Representative immunofluorescence staining showing the distribution of ITG𝛽1 (green) and SIX2 (red) in hFK (10 WGA) and WT (WT#12, favorable stage III) A) and for ITG𝛽1 (red) and CITED1 (green) in hFK (10 WGA) and WT (WT#8 favorable stage II. B) Nuclei stained with DAPI (blue); scale bars 50 and 75 μm, respectively. C) Heatmap showing gene expression profile for integrins in SIX2+CITED1+ cells from hFK (17, 17.2, and 17.5 WGA) and WT (WT#3 anaplastic stage I, WT#4: non-anaplastic, stage III, and WT#5: non-anaplastic chemo-treated, stage IV). D) Densitometric analysis by western blot (WB) of ITG𝛽1 expression in freshly isolated SIX2+CITED1+ cells from WT (WT#8,11,12, favorable stage II, favorable stage III, and favorable stage II) versus SIX2+CITED1+ cells from hFK (15,16,18 WGA) showing higher expression of ITG𝛽1 in hFK cells; 𝛽-actin was used as housekeeping protein for normalization. WB bands are presented below the graph, *p < 0.05. E) Representative immunofluorescence staining of SIX2 (red) and CITED1 (green) in SIX2+CITED1+ cells from hFK (17 WGA) cultured for 72 h with/without 1 μg mL−1 anti-ITG𝛽1 or 0.5 μg mL−1 anti-ITG𝛽4 neutralizing antibody showing increased expression of CITED1 in cells treated with anti-ITG𝛽1. Nuclei stained with DAPI (blue). Scale bar = 50 μm. F,G) Percentage of SIX2+CITED1+ cells and total SIX2+ cells from hFK (17 WGA) by flow cytometry analysis after F) 5 d or G) 28 d of culture with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody or a combination of both. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; mean ± SEM. H) Densitometric analysis by WB of LEF1 protein expression in hFK SIX2+CITED1+ cells (17 WGA) cultured for 28 d with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody 𝛽-actin was used as housekeeping control. WB bands are presented below the graph. *p < 0.05. I) Kaplan-Meier survival analysis of mice injected with WT SIX2+CITED1+ cells, without treatment (control, n = 4) or with the treatment of anti-ITG𝛽1 (n = 5) or anti-ITG𝛽4 (n = 4), endpoint tumor size 1.5 cm. J) Schematic representation showing the proposed role of ITG𝛽1 and ITG𝛽4 in WT SIX2+CITED1+ cells.

    Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

    Article Title: Identification and Characterization of the Wilms Tumor Cancer Stem Cell.

    doi: 10.1002/advs.202206787

    Figure Lengend Snippet: Figure 3. SIX2+CITED1+ cell self-renewal: the role of the extracellular matrix niche. A,B) Representative immunofluorescence staining showing the distribution of ITG𝛽1 (green) and SIX2 (red) in hFK (10 WGA) and WT (WT#12, favorable stage III) A) and for ITG𝛽1 (red) and CITED1 (green) in hFK (10 WGA) and WT (WT#8 favorable stage II. B) Nuclei stained with DAPI (blue); scale bars 50 and 75 μm, respectively. C) Heatmap showing gene expression profile for integrins in SIX2+CITED1+ cells from hFK (17, 17.2, and 17.5 WGA) and WT (WT#3 anaplastic stage I, WT#4: non-anaplastic, stage III, and WT#5: non-anaplastic chemo-treated, stage IV). D) Densitometric analysis by western blot (WB) of ITG𝛽1 expression in freshly isolated SIX2+CITED1+ cells from WT (WT#8,11,12, favorable stage II, favorable stage III, and favorable stage II) versus SIX2+CITED1+ cells from hFK (15,16,18 WGA) showing higher expression of ITG𝛽1 in hFK cells; 𝛽-actin was used as housekeeping protein for normalization. WB bands are presented below the graph, *p < 0.05. E) Representative immunofluorescence staining of SIX2 (red) and CITED1 (green) in SIX2+CITED1+ cells from hFK (17 WGA) cultured for 72 h with/without 1 μg mL−1 anti-ITG𝛽1 or 0.5 μg mL−1 anti-ITG𝛽4 neutralizing antibody showing increased expression of CITED1 in cells treated with anti-ITG𝛽1. Nuclei stained with DAPI (blue). Scale bar = 50 μm. F,G) Percentage of SIX2+CITED1+ cells and total SIX2+ cells from hFK (17 WGA) by flow cytometry analysis after F) 5 d or G) 28 d of culture with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody or a combination of both. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; mean ± SEM. H) Densitometric analysis by WB of LEF1 protein expression in hFK SIX2+CITED1+ cells (17 WGA) cultured for 28 d with/without anti-ITG𝛽1 or anti-ITG𝛽4 neutralizing antibody 𝛽-actin was used as housekeeping control. WB bands are presented below the graph. *p < 0.05. I) Kaplan-Meier survival analysis of mice injected with WT SIX2+CITED1+ cells, without treatment (control, n = 4) or with the treatment of anti-ITG𝛽1 (n = 5) or anti-ITG𝛽4 (n = 4), endpoint tumor size 1.5 cm. J) Schematic representation showing the proposed role of ITG𝛽1 and ITG𝛽4 in WT SIX2+CITED1+ cells.

    Article Snippet: #9315 1:1000 WB Cyclin D1 Abcam # 16663 1:1000 WB LEF1 (C12A5) Cell Signaling Tech.

    Techniques: Staining, Gene Expression, Western Blot, Expressing, Isolation, Cell Culture, Cytometry, Control, Injection